View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8603_low_13 (Length: 312)
Name: NF8603_low_13
Description: NF8603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8603_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 3249863 - 3249637
Alignment:
| Q |
19 |
gttctacacgcaactaaagtaatttgatatttcccttttaatttttgggttactgtaggactctattacnnnnnnnggtaacgatgtgaactcttgccaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3249863 |
gttctacacgcaactaaagtaatttgatatttcccttttaatttttgggttactgtaggactctattacaaaaaaaggtaacgatgtgaactcttgccaa |
3249764 |
T |
|
| Q |
119 |
atgaattgtcacgaagtataattcaactgtacatgtattttcagtaaaatttcttaatatacacatgctccaattaaatttattaatgtgaacgtggagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3249763 |
atgaattgtcacgaagtataattcaactgtacatgtattttcagtaaaatttcttaatatacacatgctccaattaaatttattaatgtgaacgtggagt |
3249664 |
T |
|
| Q |
219 |
acgttcctgaacttaatggaatagagc |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3249663 |
acgttcctgaacttaatggaatagagc |
3249637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University