View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8603_low_15 (Length: 286)
Name: NF8603_low_15
Description: NF8603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8603_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 5e-28; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 6118961 - 6119024
Alignment:
| Q |
20 |
gaatctagtaatattgtatgcaattaatctgctttacacgaccacctgattctattcacttgtc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6118961 |
gaatctagtaatattgtatgcaattaatctgctttacacgaccacctgattctattcacttgtc |
6119024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 253
Target Start/End: Complemental strand, 32623610 - 32623541
Alignment:
| Q |
184 |
atcaactaaatgattggccgatcaatcttattttcaaaaccttaatctttagtctatggatttattttgt |
253 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||||||||| || || |||| ||||||||||| |
|
|
| T |
32623610 |
atcaactaattgattgaccgatcaatcttattttgaaaaccttaattatttgtgtatgaatttattttgt |
32623541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 270
Target Start/End: Original strand, 6150160 - 6150246
Alignment:
| Q |
184 |
atcaactaaatgattggccgatcaatcttattttcaaaaccttaatctttagtctatggatttattttgtctatatgattttgatgt |
270 |
Q |
| |
|
||||||||| ||||| | ||| |||||||| |||||||||||| ||||| || ||| |||||||||||| | |||||||||||| |
|
|
| T |
6150160 |
atcaactaattgattcactgataaatcttatattcaaaaccttagtcttttgtgtatctatttattttgtccgtgtgattttgatgt |
6150246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University