View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8603_low_16 (Length: 267)
Name: NF8603_low_16
Description: NF8603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8603_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 257
Target Start/End: Original strand, 34040109 - 34040359
Alignment:
| Q |
7 |
acacacctcttccccaaccccaaactcttcaagagcaaaaagaggggttactctaaagcattannnnnnngactgtttcatgcaaaaataatttttgcaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34040109 |
acacacctcttccccaaccccaaactcttcaagaggaaaaagaggggttactctaaagcattatttttttgactgtttcatgcaaaaataatttttgcaa |
34040208 |
T |
 |
| Q |
107 |
gaacttatatttcatgcaacatgctcaacatttaatactttgtatcataaaatcaaaattctccaccagacattgccttgcacactagcagctaggagag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
34040209 |
gaacttatatttcatgcaacatgctcaacatttaatactttgtatcataaaatccaaattctccacaagacattgccttgcagactagcagctaggagag |
34040308 |
T |
 |
| Q |
207 |
tgaattttactctaacttccatatacaactttagatcaatggctagtatta |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34040309 |
tgaattttactctaacttccatatacaactttagatcaatggctagtatta |
34040359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University