View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8604_high_13 (Length: 219)
Name: NF8604_high_13
Description: NF8604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8604_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 33862070 - 33861888
Alignment:
| Q |
20 |
atacaccatgtatcattggcacttcagataagtggtgcccgacatatattggtgtcggacagtgtccgacatatacatatgataatactcagttacttac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33862070 |
atacaccatgtatcattggcacttcagataagtggtgcccgacatatattggtgtcggacagtgtccgacatatacatatgataatactcggttacttac |
33861971 |
T |
 |
| Q |
120 |
ttgagttggtgacatcacatttgacaaacaagacagatggatggtgtaagctaggatgaaacttggtgttaattttctccaca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
33861970 |
ttgagttggtgacatcacatttgacaaacaagacagatggatggtgtaagttaggatgaaacttggtattaattttctccaca |
33861888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 113 - 202
Target Start/End: Complemental strand, 33851883 - 33851794
Alignment:
| Q |
113 |
tacttacttgagttggtgacatcacatttgacaaacaagacagatggatggtgtaagctaggatgaaacttggtgttaattttctccaca |
202 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
33851883 |
tacttacttgagttggtgacgtcgcatttgacaaacaagacagatggatggtgtaagttaggatgaaacttggtattaattttctccaca |
33851794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University