View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8604_low_13 (Length: 236)
Name: NF8604_low_13
Description: NF8604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8604_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 54203631 - 54203448
Alignment:
| Q |
12 |
cagagagagaaagagtacattgcaggcgatgatgatgtggcggagcttggtgatgtgacgagagttctcttctttgcgtttcttagcaccttgattcgcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54203631 |
cagagagagaaagagtacattgcaggcgatgatgatgtggcggagcttggtgatgtgacgagagttctcttctttgcgtttcttagcaccttgattcgcc |
54203532 |
T |
|
| Q |
112 |
atttctctcaccaaacaacgttaccggtggctacgaaatcgctgctaattgctatgcttcttcttctgaatctgattctgattc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54203531 |
atttctctcaccaaacaacgttaccggtggcgatgaaatcgctgctaattgctatgcttcttcttctgaatctgattctgattc |
54203448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University