View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8605_low_4 (Length: 364)
Name: NF8605_low_4
Description: NF8605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8605_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 179 - 345
Target Start/End: Complemental strand, 31822629 - 31822463
Alignment:
| Q |
179 |
gactcgtttcttgtgaatcttgggttgatgagattgtgatgtaaccttatacgagttactttgcttcaacctcaatttttgtacttctagcgaggcttgc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
31822629 |
gactcgtttcttgtgaatcttgggttgatgagattgtgatgtaaccttatacgagttactttgcttcaatctcaatttttgtacttctagtgaggcttgc |
31822530 |
T |
|
| Q |
279 |
aattcttttcaccttatatgatcaacacttgcagttaaggttctcaacatattttcaatcttcatca |
345 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31822529 |
aattcttttcacctaatatgatcaacacttgcagttaaggttctcaacatattttcaatcttcatca |
31822463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 14 - 88
Target Start/End: Complemental strand, 31822777 - 31822703
Alignment:
| Q |
14 |
tggacatcaattatgggataattaggatagacttgataatgtttttataaatagaaattgattttaatttcttga |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31822777 |
tggacatcaattatgggataattaggatagacttgataatgtttttataaatagaaattgattttaatttcttga |
31822703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 101 - 137
Target Start/End: Complemental strand, 31822707 - 31822671
Alignment:
| Q |
101 |
cttgattatttgaattcttgttagaaccttcaaaaaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31822707 |
cttgattatttgaattcttgttagaaccttcaaaaaa |
31822671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University