View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_high_26 (Length: 254)
Name: NF8606A_high_26
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 6050108 - 6049897
Alignment:
| Q |
18 |
ttaggttacagctagtaattaaatgagta-cataatacccacagatggtgctaatgatggtacaatttaggataggagtattatatctctcaaggttata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
6050108 |
ttaggttacagctagtaattaaatgagtaacataatacccacagatggtgctaatgatggtacaatttaggatatgagtattatatatctcaaggttata |
6050009 |
T |
 |
| Q |
117 |
tataacatgattcatga-tatacat-aacctattttcactgtattttaagtttggtagcaattttattcgaaaatatgaatatgaatgaattacaaaaca |
214 |
Q |
| |
|
||||||||||| | | ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6050008 |
tataacatgatatacaattatacataaacctattttcactgtattttaagtttggtagcaattttattcgaa------aatatgaatgaattacaaaaca |
6049915 |
T |
 |
| Q |
215 |
aaaaactacatggacact |
232 |
Q |
| |
|
||||| |||||| ||||| |
|
|
| T |
6049914 |
aaaaagtacatgaacact |
6049897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University