View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_high_28 (Length: 250)
Name: NF8606A_high_28
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 6050213 - 6050438
Alignment:
| Q |
1 |
gtgattatatctaatctaaatagatagactgcacttttatttattttatactgcaaacaaaactctttgaccaatataatatatgtatacttttttacgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6050213 |
gtgattatatctaatctaaatagatagactgcacttttatttattttatactgcaaacaaaacactttgaccaatataatatatgtatacttttttacgt |
6050312 |
T |
|
| Q |
101 |
gtgtagtatacatagctatctatctatgcttacatagtaaatcatgaagaaaaaataacctcctataacattattagcaaagcctatttttgaccaaaac |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6050313 |
gtgtagta--catagctatctatctatgcttacatagtaaatcatgaagaaaaaataacctcccataacattattagcaaagcctatttttgaccaaaac |
6050410 |
T |
|
| Q |
201 |
tacttgttctatccgacggatttgcatt |
228 |
Q |
| |
|
||||||||||||| ||||| |||||||| |
|
|
| T |
6050411 |
tacttgttctatctgacggttttgcatt |
6050438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University