View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8606A_high_30 (Length: 246)

Name: NF8606A_high_30
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8606A_high_30
NF8606A_high_30
[»] chr4 (1 HSPs)
chr4 (23-246)||(31741369-31741593)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 23 - 246
Target Start/End: Original strand, 31741369 - 31741593
Alignment:
23 attagatgctcgatgaaacttttttcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31741369 attagatgctcgatgaaacttttttcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca 31741468  T
123 aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcatttagtcagagaatcgag 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||    
31741469 aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcatgtagtcagagaatctag 31741568  T
223 a-cctttggattcatccattttgga 246  Q
    | |||||||||||||||||||||||    
31741569 accctttggattcatccattttgga 31741593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University