View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_high_32 (Length: 230)
Name: NF8606A_high_32
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 46953202 - 46952993
Alignment:
| Q |
1 |
gtacgtatatttaatcattttatgatacacttttgatgaattatatacccttttttgtatatccttttcattgaattttgacactaattgcattttgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46953202 |
gtacgtatatttaatcattttatgatacacttttgatgaattatataccctttt--------------cattgaattttgacactaattgcattttgggt |
46953117 |
T |
|
| Q |
101 |
ttgattaggttgtttaattatggcattggtatacaccttctccaatcagatgatccagaaagtatgaccaagaatgtgcacattaatccaaaggacaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46953116 |
ttgattaggttgtttaattatggcattggtatacaccttctccaatcagatgatccagaaagtatgaccaagaatgtgcacattaatccaaaggacaacc |
46953017 |
T |
|
| Q |
201 |
atatttcattccaagtaaatctct |
224 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
46953016 |
atatttcattccaagtacatctct |
46952993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 32249147 - 32249110
Alignment:
| Q |
181 |
cattaatccaaaggacaaccatatttcattccaagtaa |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32249147 |
cattaatcccaaggacaaccatatttcattccaagtaa |
32249110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University