View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_120 (Length: 283)
Name: NF8606A_low_120
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_120 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0027 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 46110 - 46325
Alignment:
| Q |
1 |
gtttagactcattttcaactaatgatcacttatacatcaacactacatattcaaatgcgtatttagatcgctttaatcatgtaactttttgtaggcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46110 |
gtttagactcattttcaactaatgatcacttatacatcaacactacatattcaaatgcgtatttagatcgctttaatcatgtaactttttgtaggcatta |
46209 |
T |
|
| Q |
101 |
ttataccgatttatgatattgacttcaatgatgtaaatttagttgcaaattcatcttttaagtttcaatgacacaaaatttttattgttcttgattttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46210 |
---taccgatttatgatattgacttcaatgatgtaaatttagttgcaatttcatcttttaagtttcaatgacacaaaatttttattgttgttgattttat |
46306 |
T |
|
| Q |
201 |
ctaccgattcaaatgaata |
219 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
46307 |
ctaccgatttaaatgaata |
46325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 160
Target Start/End: Complemental strand, 51629039 - 51628989
Alignment:
| Q |
110 |
tttatgatattgacttcaatgatgtaaatttagttgcaaattcatctttta |
160 |
Q |
| |
|
|||||| |||| |||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
51629039 |
tttatgctattaacttaaatgatgtgaatttatttgcaaattcatctttta |
51628989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University