View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_142 (Length: 265)
Name: NF8606A_low_142
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_142 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 27662450 - 27662216
Alignment:
| Q |
12 |
ggacggcctctagttttttatgatattactcttgctctcaaaaggctcgatgtttgcatattttcggtaattcctcatgcttctgactgttcactgttta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27662450 |
ggacggcctctagttttttatgatattactcttgctctcaaaatgctcgatgtttgcatattttcggtaattcctcatgcttctgactgttcactgttta |
27662351 |
T |
|
| Q |
112 |
tgaagtctgcacaatgttcaaacatctaacttccttgagcagtgtttagttactcatgaaaaaacaagtaattaacagatcttacataggtggannnnnn |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27662350 |
tgaagtctgcacaatgttcaaacatctaacttccttgagcagtgtttagttactcatgaaaaaacaagtaattaacagatcttacttaggtggatttttt |
27662251 |
T |
|
| Q |
212 |
nnactcaaaccaagtcaagtcttttcattgctaat |
246 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
27662250 |
ttactcaaaccaagttaagtcttttcattgctaat |
27662216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 41301711 - 41301784
Alignment:
| Q |
16 |
ggcctctagttttttatgatattactcttgctctcaaaaggctcgatgtttgcatattttcggtaattcctcat |
89 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||||||| ||| | ||||||| ||||||||| || ||||| |
|
|
| T |
41301711 |
ggcccctagtattttatgatatcactcttgctctcaaaatgcttggactttgcatcttttcggtatttactcat |
41301784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University