View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_163 (Length: 252)
Name: NF8606A_low_163
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_163 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 40442329 - 40442101
Alignment:
| Q |
20 |
acatgtatggacatagaaaagtaatcagtgcctcaatctcaaggatgtccaaaatattgatcaagttggtaaaagattgtgtggttgtgttgtacctaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40442329 |
acatgtatggacatagaaaagtaatcagtgcctcaatcacaaggatgtccaaaatattgatcaagttggtaaaagattgtgtggttgtgttgtgcctaca |
40442230 |
T |
|
| Q |
120 |
gattccagggataagagttaagacaagtggattccacttttagtttctatcatactccgtgtgcttgaaaatttgtatactcattaaaattttgtgaaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40442229 |
gattccagggataagagttaagacaagtggattccacttttagtttctatcatactccgtgtgcttgaaaatttgtatactcattaaaattttgtgaaga |
40442130 |
T |
|
| Q |
220 |
aaatttgtacgcaagtaaagatgcatcag |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40442129 |
aaatttgtacgcaagtaaagatgcatcag |
40442101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University