View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_167 (Length: 251)
Name: NF8606A_low_167
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_167 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 37324793 - 37324562
Alignment:
| Q |
1 |
tactttcacgacatcgtgtcaggaccaaaaccaagcatggtatttgtagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtgg |
100 |
Q |
| |
|
|||||||| ||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37324793 |
tactttcatgacattgtgtcgggaccaaaaccaagcatggtatttatagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtgg |
37324694 |
T |
|
| Q |
101 |
ccatggacgatccattgacggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37324693 |
ccatggacgatccattgacggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacttctatatcacaagaggagatgggact |
37324594 |
T |
|
| Q |
201 |
aatgatggtgatgaccatggcattcactgatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37324593 |
aatgatggtgatgaccatggcattcactgatg |
37324562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 37317233 - 37317002
Alignment:
| Q |
1 |
tactttcacgacatcgtgtcaggaccaaaaccaagcatggtatttgtagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37317233 |
tactttcacgacatcgtgtcaggaccaaaacctagcatggtatttgtagctgagcccaatggcaaggtaaaaaatgcgttgccattcgggaccgttgtgg |
37317134 |
T |
|
| Q |
101 |
ccatggacgatccattgacggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggact |
200 |
Q |
| |
|
||||||| || |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
37317133 |
ccatggatgacccattgactgctggtcctgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacttcaatatcacaagaggagatgggact |
37317034 |
T |
|
| Q |
201 |
aatgatggtgatgaccatggcattcactgatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37317033 |
aatgatggtgatgaccatggcattcactgatg |
37317002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 37320812 - 37320581
Alignment:
| Q |
1 |
tactttcacgacatcgtgtcaggaccaaaaccaagcatggtatttgtagctgagcctaatggcaaggtaaaaaatgcgttgccattcgggacggttgtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
37320812 |
tactttcacgacatcgtgtcaggaccaaaacctagcatggtatttgtagctgagcccaatggcaaggtaaaaaatgccttgccattcgggacagttgtgg |
37320713 |
T |
|
| Q |
101 |
ccatggacgatccattgacggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggact |
200 |
Q |
| |
|
| ||||| || || ||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320712 |
cgatggatgaccccttgacggctggacccgaacgtgaatcaaaacttgtgggtaaggctcaaggaatttacacctctatatcacaagaggagatgggact |
37320613 |
T |
|
| Q |
201 |
aatgatggtgatgaccatggcattcactgatg |
232 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
37320612 |
aatgatggtgatgaccatgacattcactgatg |
37320581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 82 - 215
Target Start/End: Complemental strand, 37306807 - 37306674
Alignment:
| Q |
82 |
ccattcgggacggttgtggccatggacgatccattgacggctgggcccgaacgtgactcgaaacttgtgggtaaggctcaaggaatttacacctctatat |
181 |
Q |
| |
|
||||||||||| || ||||||||||| ||||| |||||| |||||| |||| |||||||||||| |||||||| ||||||||||||||| | |||| |
|
|
| T |
37306807 |
ccattcgggacagtggtggccatggatgatccgttgacgattgggcctgaacttgactcgaaactcgtgggtaaagctcaaggaatttacgctgtaatat |
37306708 |
T |
|
| Q |
182 |
cacaagaggagatgggactaatgatggtgatgac |
215 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| |
|
|
| T |
37306707 |
cacaagatgagatgggactaatgatggttatgac |
37306674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University