View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_187 (Length: 248)
Name: NF8606A_low_187
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_187 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 24 - 119
Target Start/End: Original strand, 2694258 - 2694353
Alignment:
| Q |
24 |
aacaaatggggaagcagcattgatcctgtgtttagagagtgttgctactgatcttgttttctggtgaaggagagaaaatgtagattgaaaataaca |
119 |
Q |
| |
|
||||| |||||||||| ||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2694258 |
aacaagtggggaagcaacatagattctgtgtttagagagtgttgctactgatcttgtcttctggtgaaggagagaaaatgtagattggaaataaca |
2694353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 74
Target Start/End: Original strand, 2687228 - 2687290
Alignment:
| Q |
12 |
gagatggacatcaacaaatggggaagcagcattgatcctgtgtttagagagtgttgctactga |
74 |
Q |
| |
|
|||||| ||| ||| || |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2687228 |
gagatgtacaacaagaagtggggaagcaacattgatcctgtgtttagagagtgttgctactga |
2687290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 227
Target Start/End: Original strand, 2694408 - 2694445
Alignment:
| Q |
190 |
taaataatatctggaatctatgtccatatgtttgattt |
227 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
2694408 |
taaataatatcaggaatctatgtccatatgtttaattt |
2694445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University