View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_199 (Length: 246)
Name: NF8606A_low_199
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_199 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 23 - 246
Target Start/End: Original strand, 31741369 - 31741593
Alignment:
| Q |
23 |
attagatgctcgatgaaacttttttcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31741369 |
attagatgctcgatgaaacttttttcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca |
31741468 |
T |
|
| Q |
123 |
aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcatttagtcagagaatcgag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
31741469 |
aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcatgtagtcagagaatctag |
31741568 |
T |
|
| Q |
223 |
a-cctttggattcatccattttgga |
246 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
31741569 |
accctttggattcatccattttgga |
31741593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University