View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_230 (Length: 239)
Name: NF8606A_low_230
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_230 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 43094746 - 43094907
Alignment:
| Q |
1 |
caggaacaagactgtttcatgatatcttatccaccccgctgttagcaaaaacacatgcaaaagtcaattccccacaactgtgtttagacagctctatagg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094746 |
caggaacaagactgtgtcatgatatcttatccaccccgctgttagcaa------------aagtcaattccccacaactgtgtttagacagctctatagg |
43094833 |
T |
|
| Q |
101 |
atttattacaattctctatttaaatacctactattgctaactgtgttttattctatcaaatcaaaaattgattt |
174 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43094834 |
atttatcacaattctctatttaaatacctactattgctaactgtgttttattctatcacatcaaaaattgattt |
43094907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University