View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_232 (Length: 239)
Name: NF8606A_low_232
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_232 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0002 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 239
Target Start/End: Complemental strand, 337503 - 337270
Alignment:
| Q |
6 |
agtagcatagattcataacagaggagcagaggttccaaaagctggtcggttgtttcatagtaatcagaaggatcaagttcacatggacaatcctctagaa |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337503 |
agtaccatagattcataacagaggagcagaggttccaaaagctgttcggttgtttcatagtaatcagaaggatcaagttcacatggacaatcctctagaa |
337404 |
T |
|
| Q |
106 |
gcagttccaatcgtctacgagttctctgtagctaaacatgtgcacagaagagaatgcatttactatcgtgcctttgattgacaatttaacattaccaatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337403 |
gcagttccaatcgtctacgagttctctgtagctaaacatgtgcacagaagagaatgcatttactatcgtgcctttgattgacaatttaacattaccaatt |
337304 |
T |
|
| Q |
206 |
cataggacaacaaggaaaacaaaattgttcagta |
239 |
Q |
| |
|
||||||||||||| |||||| | |||||||||| |
|
|
| T |
337303 |
cataggacaacaaagaaaactagtttgttcagta |
337270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 14 - 124
Target Start/End: Complemental strand, 42173183 - 42173073
Alignment:
| Q |
14 |
agattcataacagaggagcagaggttccaaaagctggtcggttgtttcatagtaatcagaaggatcaagttcacatggacaatcctctagaagcagttcc |
113 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| | ||||||||| ||||| |||||||| ||||||| | |||||| ||||| ||||| |
|
|
| T |
42173183 |
agattcataactgaggagcagaggatccaaaagctggtcagctgtttcataataatccaaaggatcatagtcacatgcaacatcctcaagaagaagttct |
42173084 |
T |
|
| Q |
114 |
aatcgtctacg |
124 |
Q |
| |
|
|| |||||||| |
|
|
| T |
42173083 |
aaccgtctacg |
42173073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University