View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_236 (Length: 239)
Name: NF8606A_low_236
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_236 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 38932240 - 38932026
Alignment:
| Q |
1 |
gttcgttatgtgaaacagggtgaccttattgctattccacctggtgttccttactggacctacaattgcggcaataccccgcttattgttgtcactctcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
38932240 |
gttcgttatgtgaaacagggtgaccttattgctattccacctggtgttccttactggacctacaattacggcaatacccctcttattattgtcactctcc |
38932141 |
T |
 |
| Q |
101 |
tcgacacttccaataaactaaaccaactcgatcgtatcccaagagtaagcaacattaattataatctaacaattactcctaaatgcaaccaactttgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932140 |
tcgacacttccaataaactaaaccaactcgatcgtatcccaagagtaagcaacattaattataatctaacaattactcctaaatgcaaccaactttgtta |
38932041 |
T |
 |
| Q |
201 |
tatatgaatgattca |
215 |
Q |
| |
|
||||| ||| ||||| |
|
|
| T |
38932040 |
tatataaatcattca |
38932026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University