View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_249 (Length: 235)
Name: NF8606A_low_249
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_249 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 107 - 229
Target Start/End: Complemental strand, 24987536 - 24987414
Alignment:
| Q |
107 |
aacattttagaatttcttattttcttttagggaaatcggaaattatgtactaataaattatatcaaactcttttctttttaccaaaaattagcaaaatgt |
206 |
Q |
| |
|
||||||||| | ||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24987536 |
aacattttaaatttttttttttttttttagggaaatcggaaattatgtactaataaattatatcaaactcttttctttttaccaaaaattagcaaaatgt |
24987437 |
T |
|
| Q |
207 |
aataaatatttttaagaccattt |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
24987436 |
aataaatatttttaagaccattt |
24987414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 5 - 67
Target Start/End: Complemental strand, 34460707 - 34460645
Alignment:
| Q |
5 |
agtttggtgttgccatatattaaacaagatgtatgtttccaaattcctatatttcaaaactta |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||| |
|
|
| T |
34460707 |
agtttggtgttgccatatattaaacaagatgtaggcttccaaattcctatatttcataactta |
34460645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University