View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_258 (Length: 230)
Name: NF8606A_low_258
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_258 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 43094762 - 43094549
Alignment:
| Q |
1 |
acacagtcttgttcctgccccacccttcctctatcaatggctccaccttcttttatcatgtctcttgatatatagttgataaattgaggaaaaacatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094762 |
acacagtcttgttcctgccccacccttcctctatcaatggctccaccttcttttatcatgtctcttgatatatagttgataaattgaggaaaaacatatg |
43094663 |
T |
 |
| Q |
101 |
taatacattaacgagccatcaatctaccagcaagatttgcattggtatactataattttaaattaaacgtaagatagatagagcctggttggaagcatcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094662 |
taatacattaacgagccatcaatctaccaacaagatttgcattggtatactataattttaaatcaaacgtaagatagatagagcctggttggaagcatcc |
43094563 |
T |
 |
| Q |
201 |
gtttttatgttgag |
214 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
43094562 |
gttttaatgttgag |
43094549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University