View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_279 (Length: 229)
Name: NF8606A_low_279
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_279 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 28586921 - 28587099
Alignment:
| Q |
19 |
gtaatatatatggatacagaatatatggggagattggtaaaatatatgagtagattaaagctaatggtgtcatacactcatactatcatttcactaaatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586921 |
gtaatatatatggatacagaatatatggggagattggtaaaatatatcagtagattaaagttaatggtgtcatacactcatactatcatttcactaaatc |
28587020 |
T |
 |
| Q |
119 |
caatcatattttataaaatagaaaagttaacaagaaaaggtaaacgtttaccatatgttcccaagtatagatctatgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28587021 |
caatcatattttataaaatagaaaagttaacaagaataggtaaacgtttaccatatgttcccaagtatagatctttgtt |
28587099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University