View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_296 (Length: 226)
Name: NF8606A_low_296
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_296 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 32892062 - 32891858
Alignment:
| Q |
15 |
acatcaaagaacttggaatacaatgaagaacatcaaattgctgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892062 |
acatcaaagaacttggaatacaatgaagaacatcaaattgttgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
32891963 |
T |
|
| Q |
115 |
gttttctggtcatgttagaaaattcttgcggaccatagcgttccaagggaaacgcactctttggaacttttcgacgtctattgttgggtggggggatatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32891962 |
gttttctggtcatgttagaaaattcttgcggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgttgggtggggggatttt |
32891863 |
T |
|
| Q |
215 |
gttgg |
219 |
Q |
| |
|
||||| |
|
|
| T |
32891862 |
gttgg |
32891858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University