View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_298 (Length: 225)
Name: NF8606A_low_298
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_298 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 16438208 - 16438403
Alignment:
| Q |
15 |
acatcaacacaaaaatggcagcgacagtggagattgatccaaatcgaaggtgacaaagagcagataaagaaagagaaacaaaacaaacccccaaaaatgg |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||| | ||| ||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
16438208 |
acatcaacacaaaaatggcagcgactttggagatggatccaaatcgaaggtaacaaag-gtagacaaagaaagaaaaacaaaacaaaccctcaaaaatgg |
16438306 |
T |
|
| Q |
115 |
aatcaacccgcaaactcgtcatcatcacttcaaccaaaattcaccaccgcgctc-aaatcaccattaaaattcaaactcccaacccaacaacaccaa |
210 |
Q |
| |
|
|| |||||| ||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
16438307 |
aaccaacccacaaactcctcatcatcacttcaaccaaaattcaccaccacgctcaaaatcaccattaaaattcaaacttctaacccaacaacaccaa |
16438403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University