View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_306 (Length: 220)
Name: NF8606A_low_306
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_306 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 48484394 - 48484180
Alignment:
| Q |
1 |
tacatgatcaggtcttatggtgcatttcagtctcatgttctctttcaaatacatttttgaaatggagaaacttagtttacttttactttattgcctcaga |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484394 |
tacatgatcaggtcttatggtacatttcagtcttatgttctctttcaaatacatttttgaaatggagaaacttagtttacttttactttattgcctcaga |
48484295 |
T |
|
| Q |
101 |
aaaatatgaaccagtttatgcaaaatggacaacagagagatgtgcgatttgcagatgggtagaagattgggaagataacaagattattatatgtaacagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484294 |
aaaatatgaaccagtttatgcaaaatggacaacagagagatgtgcgatttgcagatgggtagaagattgggaagataacaagattattatatgtaacagg |
48484195 |
T |
|
| Q |
201 |
tgctataatcatcgt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48484194 |
tgctataatcatcgt |
48484180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 201
Target Start/End: Original strand, 10036323 - 10036419
Alignment:
| Q |
105 |
tatgaaccagtttatgcaaaatggacaacagagagatgtgcgatttgcagatgggtagaagattgggaagataacaagattattatatgtaacaggt |
201 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||| |||||||| ||||| |||||| | ||||| | || |||||||| ||||| || || ||||||| |
|
|
| T |
10036323 |
tatgagccagttcatgcaaaatggacgacagaaagatgtgctatttgtagatggatcgaagactatgaggataacaaaattatcatctgcaacaggt |
10036419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University