View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_308 (Length: 220)
Name: NF8606A_low_308
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_308 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 7617751 - 7617833
Alignment:
| Q |
1 |
ttttgctttgaacaacaaagtacaaacataaattaagaccagacaatttttaaggttaagcaccatgtctgactcagatataa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617751 |
ttttgctttgaacaacaaagtacaaacataaattaagaccagacaatttttaaggttaagcaccatgtctgactcagatataa |
7617833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 141 - 214
Target Start/End: Original strand, 7617891 - 7617964
Alignment:
| Q |
141 |
aaacaaaacaagccaaacccaaccttaatcttccaccaggaagaatgggttggcctttcattggagaaactatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617891 |
aaacaaaacaagccaaacccaaccttaatcttccaccaggaagaatgggttggcctttcattggagaaactatt |
7617964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University