View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_310 (Length: 219)
Name: NF8606A_low_310
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_310 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 5 - 114
Target Start/End: Complemental strand, 12122859 - 12122750
Alignment:
| Q |
5 |
agtttggtgttattggttttatggattctgtctaaagtaatcttcattatgtccctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122859 |
agttcggtgttattggttttatggattctgtctaaagtaatcttcattatgtctctctattttgatagtctgtcctctatctcacgtgtttcccctctcc |
12122760 |
T |
|
| Q |
105 |
cagcttatca |
114 |
Q |
| |
|
|||||||||| |
|
|
| T |
12122759 |
cagcttatca |
12122750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University