View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_312 (Length: 219)
Name: NF8606A_low_312
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_312 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 31997905 - 31998088
Alignment:
| Q |
14 |
aagaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatttca |
113 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31997905 |
aagaaaatgcctcgtggacgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatttct |
31998004 |
T |
|
| Q |
114 |
tggtaacagttggtttgtttatctttctggctctgcataagaattggatttcaannnnnnnaatcaaagtcttttgacctattt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
31998005 |
tggtcacagttggtttgtttatctttctggctctgcataagaattggattttaatttttttaatcgaagtcttttgacctattt |
31998088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 11 - 105
Target Start/End: Original strand, 15843026 - 15843120
Alignment:
| Q |
11 |
tcgaagaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgct |
105 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| ||||||| |||| ||||| |
|
|
| T |
15843026 |
tcgaagaaaatacctcgtggatgtggacttgcatagtaggagatggtcttgttggagggggcaatgtgcctctggagggaagtacattacctgct |
15843120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University