View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_328 (Length: 208)
Name: NF8606A_low_328
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_328 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 35 - 156
Target Start/End: Complemental strand, 47358771 - 47358650
Alignment:
| Q |
35 |
attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358771 |
attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg |
47358672 |
T |
|
| Q |
135 |
tctgcctgacttgtaaagcttt |
156 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47358671 |
tctgcctgacttgtaaagcttt |
47358650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University