View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_329 (Length: 208)
Name: NF8606A_low_329
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_329 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 191
Target Start/End: Original strand, 43260903 - 43261073
Alignment:
| Q |
21 |
tgagagataaaccttaacaggaggagaagaagctgccttgacaacaaaggaaccttttctagaagaccctattgaagatgggagtgatcttgctccaaaa |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43260903 |
tgagagatagaccttaacaggaggagaagaagctgccttgacaacaaaggaaccttttctagaagaccctattgaagatgggagtgatcttgctccaaaa |
43261002 |
T |
|
| Q |
121 |
ctctgcctcacagcttcagctgcaaaagtaagagatgatgacgacactagagcttgtgtagccatgttttt |
191 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43261003 |
ctctgtctcacagcttcagctgcaaaagtaagagatgatgacgacactagagcttgtgtagccatgttttt |
43261073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 51 - 191
Target Start/End: Original strand, 43257337 - 43257477
Alignment:
| Q |
51 |
agctgccttgacaacaaaggaaccttttctagaagaccctattgaagatgggagtgatcttgctccaaaactctgcctcacagcttcagctgcaaaagta |
150 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
43257337 |
agctgccttgacaacaaaggatccttttctagaagacccaattgaagatgggagtgatcttgctccaaaactctgtcttacagcttcagctgcaaaagta |
43257436 |
T |
|
| Q |
151 |
agagatgatgacgacactagagcttgtgtagccatgttttt |
191 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
43257437 |
agagatgacgacgacaatagaacttgtgtagccatgttttt |
43257477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University