View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_330 (Length: 207)
Name: NF8606A_low_330
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_330 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 14784643 - 14784811
Alignment:
| Q |
18 |
aatatggcgaggtatttggaggcaaacataagttcaggtagagctaccaagggaaagtttcataacatcgttgacaaaattaaaagcagagtaagtggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14784643 |
aatatggcgaggtatttggaggcaaacataagtccaggtagagctaccaagggaaagtttcataacatcgttgacaaaattaaaagcagagtaagtggtt |
14784742 |
T |
|
| Q |
118 |
tggaagcaacaatgcttaagttttgatggcaaacttattccatctaaatcagctttgagctcttatcat |
186 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
14784743 |
tggaagcaacaatgcttgagttttgatggcaaacttacgctatctaaatcagttttgagctcttatcat |
14784811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 48899396 - 48899233
Alignment:
| Q |
15 |
aataatatggcgaggtatttggaggcaaacataagttcaggtagagctaccaagggaaagtttcataacatcgttgacaaaattaaaagcagagtaagtg |
114 |
Q |
| |
|
|||||||||| | |||||||| ||| ||||| ||| ||||||||||||| | |||||||||||||||| || ||||||||||| ||| ||| |||||| |
|
|
| T |
48899396 |
aataatatgggcaagtatttgggggctaacattagtgcaggtagagctactaggggaaagtttcataacgtcattgacaaaattcaaaatagactaagtg |
48899297 |
T |
|
| Q |
115 |
gtttggaagcaacaatgcttaagttttgatggcaaacttattccatctaaatcagctttgagctct |
180 |
Q |
| |
|
| |||||||||||||||||| ||||||| || | ||||| | |||||||| || |||||||||| |
|
|
| T |
48899296 |
g-ttggaagcaacaatgctt-agttttgtcggtagacttactttatctaaattagttttgagctct |
48899233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 31117017 - 31116854
Alignment:
| Q |
15 |
aataatatggcgaggtatttggaggcaaacataagttcaggtagagctaccaagggaaa-gtttcataacatcgttgacaaaattaaaagcagagtaagt |
113 |
Q |
| |
|
|||||||||| | |||||||| || |||||| ||| |||||||| | || | || ||| ||||||||||||| |||| |||||| ||| |||| ||||| |
|
|
| T |
31117017 |
aataatatgggcaagtatttgggggaaaacatcagtccaggtagatccactagggaaaaagtttcataacatcattgaaaaaattcaaaacagactaagt |
31116918 |
T |
|
| Q |
114 |
ggtttggaagcaacaatgcttaagttttgatggcaaacttattccatctaaatcagctttgagct |
178 |
Q |
| |
|
|| |||||||||| ||||||||||||||| | || ||||| | |||||||||||||||||||| |
|
|
| T |
31116917 |
gg-ttggaagcaataatgcttaagttttgccgacagacttactttatctaaatcagctttgagct |
31116854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University