View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_331 (Length: 207)
Name: NF8606A_low_331
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_331 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 85 - 194
Target Start/End: Complemental strand, 41376155 - 41376045
Alignment:
| Q |
85 |
ttaaatctagtcttcctttcttcttccatgcggtcttgtcaattaannnnnnn-cagggtttctaaatccagtaaattgattttgtcatatatatccatt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41376155 |
ttaaatctagtcttcctttcttcttccatgcggtcttgtcaattaattttttttcagggtttctaaatcctgtaaattgattttgtcatatatatccatt |
41376056 |
T |
 |
| Q |
184 |
aagtgatgtcc |
194 |
Q |
| |
|
|||| |||||| |
|
|
| T |
41376055 |
aagttatgtcc |
41376045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University