View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_332 (Length: 207)
Name: NF8606A_low_332
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_332 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 183
Target Start/End: Complemental strand, 32096520 - 32096357
Alignment:
| Q |
20 |
aagaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattgttgagagtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32096520 |
aagaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtg |
32096421 |
T |
|
| Q |
120 |
atgctttgttggagattgagtgtttgcatagagaaggattgttgcttgttgttatggtaatgtt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32096420 |
atgctttgttggagattgagtgtttgcatagagaaggattgttgcttgacgttatggtaatgtt |
32096357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University