View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_333 (Length: 207)
Name: NF8606A_low_333
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_333 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 37667652 - 37667557
Alignment:
| Q |
15 |
tgagatggagttttgtgttttgatgtttagattaagtcctcaattgatggaagagtcatggtttttgcttgaagaagcattggatcatgaacttaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37667652 |
tgagatggagttttgtgttttgatgtttagattaagtcctcaattgatggaagagtcatggtttttgcttgaagaagcattggatcatgaacttaa |
37667557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 17 - 92
Target Start/End: Original strand, 21941661 - 21941736
Alignment:
| Q |
17 |
agatggagttttgtgttttgatgtttagattaagtcctcaattgatggaagagtcatggtttttgcttgaagaagc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| |||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
21941661 |
agatggagttttgtgttttgatgtttaggttgagtcctgaattgatggaagagtcttggttttggcttgaggaagc |
21941736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University