View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_334 (Length: 206)
Name: NF8606A_low_334
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_334 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 27 - 187
Target Start/End: Original strand, 52478154 - 52478313
Alignment:
| Q |
27 |
ttaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacatttaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478154 |
ttaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacatttaca |
52478253 |
T |
 |
| Q |
127 |
ccatcactttaccgttttttatttgtataagttaattataacggtgatcttttttaatatt |
187 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52478254 |
ccatcactttacc-tttattatttgtataagtaaattataacggtgatcttttttaatatt |
52478313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University