View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_337 (Length: 205)
Name: NF8606A_low_337
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_337 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 22676884 - 22676810
Alignment:
| Q |
92 |
atgacattttctaaagtgaggacaacactttcatttgagcaaggatcaatatcttaccttcttccgattgtggag |
166 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22676884 |
atgactttttctaaagtgaggcaaacactttcatttgagcaaggatcaatatcttaccttcttccaattgtggag |
22676810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University