View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606A_low_74 (Length: 334)
Name: NF8606A_low_74
Description: NF8606A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606A_low_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 5188283 - 5188609
Alignment:
| Q |
1 |
atcttagagggagaccaacccattcgataacttcactattatttttctttcttcttccacnnnnnnn-ctcaactattattgttggcatctactatttgc |
99 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
5188283 |
atcttagagggagaccaacc-attcgataacttcactattatttttctttcttcttccaaaaaaaaaactccactattattgttggcatctactatttgc |
5188381 |
T |
|
| Q |
100 |
taaaagaatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatattatgtcatcgg |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5188382 |
taaaaggatatactatatggcatatgcaaggcaacgtacttcagcatgcttatttttatgagaattaagtattccaagtcaattaatattatgtcatcgg |
5188481 |
T |
|
| Q |
200 |
aatattccttgttccnnnnnnnnncgtagctgtcattttgatgaataaaataattcatatatactgtataggaagggatttggaatctgcatcaaaccct |
299 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5188482 |
aatattccttgtacctttttttttcgtagctgtcattttgatgaataaaataattcatatatactgtata-gaagggatttggaatctgcatcaaaccct |
5188580 |
T |
|
| Q |
300 |
tgcgtcgttgtgttgcatgatgaatgaaa |
328 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5188581 |
tgcgtcgttgtgttgcatgatgaatgaaa |
5188609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University