View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606_high_7 (Length: 220)
Name: NF8606_high_7
Description: NF8606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 97 - 220
Target Start/End: Complemental strand, 40193601 - 40193478
Alignment:
| Q |
97 |
tctttattttctcttatctctatcatattatacacattttcggtgaataatcacatccaatgattcatcagcactaagatgtacaagatttatttcctnn |
196 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193601 |
tctttatcttctcttatctctatcatatcatacacattttcggtgaataatcacatccaatgattcatcagcactaagatgtacaagatttatttcctaa |
40193502 |
T |
 |
| Q |
197 |
nnnnngatgttatcaacttttgca |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40193501 |
aaaaagatgttatcaacttttgca |
40193478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University