View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606_low_3 (Length: 400)
Name: NF8606_low_3
Description: NF8606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606_low_3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 103 - 400
Target Start/End: Complemental strand, 40660450 - 40660153
Alignment:
| Q |
103 |
aaggtttatggtgcaccgcaccgcatctagttctaacatgggtggagctatggtttcattgttctccagcttcttcgaccctccataatgataagtttcc |
202 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40660450 |
aaggtttatggtgtaccgcactgcaactagttctaacatggatggagctatggtttcatcgttctccagcttcttcgaccctccattatgataagtttct |
40660351 |
T |
 |
| Q |
203 |
aatctagctttgacgcttgcaattgtgtgttgtttgatctccggagcatgacaattggcttatgccaatgatcaatcaaattgtgtttgatactaattgg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660350 |
aatctagctttgacgcttgcaattgtgtgttgtttgatctccggagcatgacaattggcttatgccaatgatcaatcaaattgtgtttgatactaattgg |
40660251 |
T |
 |
| Q |
303 |
ttactttttggtttaataaatgggattctatagaggatactaaaatcataagattatatggaccctactccaagtacatcactgctgcaggatttaaa |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660250 |
ttactttttggtttaataaatgggattctatggaggatactaaaatcataagattatatggaccctactccaagtacatcactgctgcaggatttaaa |
40660153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University