View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606_low_7 (Length: 247)
Name: NF8606_low_7
Description: NF8606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 28350084 - 28349891
Alignment:
| Q |
17 |
acatcaaacaaaaaggcattnnnnnnngacaatggaaacagagtggatctggattcatcggagtcgcataaacaggcacagccactgcagtcggctaaaa |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28350084 |
acatcaaacaaaaaggcattaaaaaaagacaatggaaacagagtggatctggattcaccggagtcgcgtaaacaggcacagccactgcagtcggctaaaa |
28349985 |
T |
 |
| Q |
117 |
tcaaaccgttcaattcatcaaagggttgtcattcagtgtcatcctctgtaacaccacgcatgtaatcaaaaccctattgtgcacaccaattacc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
28349984 |
tcaaaccgttcaattcatcaaagggttgtcatttagtgtcatcttctgtaacaccacgcatgtaatcaaaactctattgtgcacaccagttacc |
28349891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University