View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8606_low_9 (Length: 220)
Name: NF8606_low_9
Description: NF8606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8606_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 14430793 - 14430602
Alignment:
| Q |
20 |
aaattgaaggttttatagagtacaaggactaattactaaactaacctaaggactaaagggatagatggggaatatcttgggaccttttcgtatgttttaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14430793 |
aaattgaaggttttatagagtacaaggactaattactaaactaacctaaggactaaagggatagatggggaatatcttgggaccttttcgtatgttttaa |
14430694 |
T |
 |
| Q |
120 |
tagtttagggactaatttgcagagatagtgatagttcaggggccaaattgatggtttactctttaaattccagatcctttttctgatgtcca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14430693 |
tagtttagggactaatttgcagagatagtgatagttcaggggccaaattgatggtttactctttaaattccagatcctttttctgatgtcca |
14430602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 170
Target Start/End: Complemental strand, 52017693 - 52017637
Alignment:
| Q |
114 |
ttttaatagtttagggactaatttgcagagatagtgatagttcaggggccaaattga |
170 |
Q |
| |
|
||||||||||||||||||||||||| |||| | |||||||| |||| | ||||||| |
|
|
| T |
52017693 |
ttttaatagtttagggactaatttgttgagagaatgatagtttagggactaaattga |
52017637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University