View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8607_high_5 (Length: 239)
Name: NF8607_high_5
Description: NF8607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8607_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 2385036 - 2384821
Alignment:
| Q |
1 |
gccgttatacgacagaattttcataccgtttgctcaactgataacacgacaagaaaaaggtatcaacgtgatgcaaaggatgggaatcggaatggttctc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || || |||||||||||||| ||||||||||| || ||||||||||| ||||||||||||||||| ||| |
|
|
| T |
2385036 |
gccgttatacaacagaattttcataccgttcgcgcagctgataacacgacaggaaaaaggtataaatgtgatgcaaagaatgggaatcggaatggtactc |
2384937 |
T |
 |
| Q |
101 |
tcaatcatagcgatgattatcgcagctctagttgaaatgaaacgccttgccatcggtcgacaaatgagaagtgaaggattactatcagaaatagtaccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2384936 |
tcaatcatagcgatgattatcgcagcactagttgaaatgaaacgtcttgctatcggtcgacaaatgagaagtgaaggattactatcagaaatagtaccaa |
2384837 |
T |
 |
| Q |
201 |
taagcattttctggtt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2384836 |
taagcattttctggtt |
2384821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University