View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8609_low_4 (Length: 231)
Name: NF8609_low_4
Description: NF8609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8609_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 40442022 - 40441826
Alignment:
| Q |
13 |
gcagagatacctaccagaatgcaggatataaaccagttagatgactatgcatgaccgaccaaggagcaataacattattagcatttgatttacatatacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40442022 |
gcagagatacctaccagaatgcaggatataaaccagttagatgactatgcatgaccgaccaaggagcaataacattattagcatttgatttacatatacc |
40441923 |
T |
 |
| Q |
113 |
tcatactcacagatagaaagctcctctatttccaatcttcatcaaaagtgacttaagtattaagctccaccagataagatttgcgaaaacaattctg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40441922 |
tcatactcacagatagaaagctcctctatttccaatcttcatcaaaagtgacttaagtattaagctccaccagataagatttgcgaaaacaattctg |
40441826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University