View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8610_low_11 (Length: 263)
Name: NF8610_low_11
Description: NF8610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8610_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 13234547 - 13234285
Alignment:
| Q |
1 |
aggaagaagtatataaatgggcctctaagttctaaagcaaaccaaacaatggcagcataggctaaagcttggagcgcaagaaacggcatgtgagtgatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13234547 |
aggaagaagtatataaatgggcctctaagttctaaagcaaaccaaacaatggcagcataggctaaagcttggagcgcaagaaacggcatgtgagtgatta |
13234448 |
T |
 |
| Q |
101 |
ggctagctatggtgtaacaagaagctctataggcattatgagaagtttcgcggatgaagatgaacctctcttggatgaaggcagggaccgcatcatttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13234447 |
ggctagctatggtgtaacaagaagctctataggcattatgagaagtttcgcggatgaagatgaacctctcttggatgaaggcagggacggcatcatttga |
13234348 |
T |
 |
| Q |
201 |
agagaagaaaaacagacacactgtgaaaatgaagaaactgagacgatttgtgattccttgtaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13234347 |
agagaagaaaaacagacacactgtgaaaatgaagaaactgagacgatttgtgattccttgtaa |
13234285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University