View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8610_low_4 (Length: 407)
Name: NF8610_low_4
Description: NF8610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8610_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 17 - 384
Target Start/End: Complemental strand, 30778754 - 30778387
Alignment:
| Q |
17 |
acatcattttggtgtgatctttgactgcatggtgcaagtttgtgggttaggttttggcgtctttttgatttacgtttgataaagatgttaccttagtgga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30778754 |
acatcattttggtgtgatctttgactgcatggtgaaggtttgtgggttaggttttggcgtccttttgatttacgtttgataaaggtgttaccttagtgga |
30778655 |
T |
|
| Q |
117 |
gattaggaggctagcatgggggattgataggctagggtaaccgtggaagaagacgtctccatgtgatttagttgtcggttgtttaaga-gtttggaagga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30778654 |
gattaggaggctagcatgggggattgataggctaggatagcggtggaagaagacgtctccatgtgatttagttgtcggttgtttaagatatttggaagga |
30778555 |
T |
|
| Q |
216 |
caagaatagtcgtatttttcgacatatagatcaatcgatacagcaaccggtgaacatcgtgaagttttcttcttttagatggttacaatcgaaaattaac |
315 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30778554 |
taagaatagtcgtatttttcgacatataga-caatcgatacaacaaccggtgaatatcgtgaaattttcttcttttagatggttacaaccgaaaattaac |
30778456 |
T |
|
| Q |
316 |
aacttagcctttgattttcatcatcggtggacaagcaaaaattgcaacttagcttttgattttcatcat |
384 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30778455 |
aacttagcttttgattttcatcatcggtggacaagcaaaaattgcaacgtagcttttgattttcatcat |
30778387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University