View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8610_low_7 (Length: 301)
Name: NF8610_low_7
Description: NF8610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8610_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 17576851 - 17577141
Alignment:
| Q |
1 |
aatgaaagcttcttagggataggagagatttaatctgaaattttgtgatcctttacatgctacaactccctttttactaaaaaccataacaatatctcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17576851 |
aatgaaagcttcttagggataggagagatttaatctgaaattttgtgaccctttacatgctacaactccctttttactaaaaaccataacaatacctcgt |
17576950 |
T |
 |
| Q |
101 |
ggcataaaggttagtagtattcaggttacttgttagcattagataaaccagtttgctttcttgtgatataattttgactccatcttattgcttaannnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
17576951 |
ggcataaaggttagtagtattcaggttacttgttagcattagataaaccagtttgctttcctgtgatataattctgactccatcttattgcttaa--ttt |
17577048 |
T |
 |
| Q |
201 |
nnncccacttttgtgattgaaattgctccataatgaaatgatgattaaatgatttttatcgcaggatgtggcaaggatttcttggttcttctc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17577049 |
tttcccacttttgtgattgaaattgctccataatgaaatgatgattaaatgatttttatcgcaggatgtggcaaggatttcttggttcttctc |
17577141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University