View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8610_low_8 (Length: 294)
Name: NF8610_low_8
Description: NF8610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8610_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 39092245 - 39091967
Alignment:
| Q |
1 |
tctggtctttgtcttggttcaaagtgtgtgtgcgtgtctagtatttggtttggtggcttttgtatgatactatgagcatccataacgggagtatatgggg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39092245 |
tctggtctctgtcttggttcaaagtgtgtgtg--tgtctagtatttggtttggtggcttttgtatgatactatgagcatccataacgggagtatatggag |
39092148 |
T |
|
| Q |
101 |
tggatgtggctaattatctttacagtatgttaatccttcattaccttcaattgtcatttggtagtactcatggctaactttacaagaaggg-attggctt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39092147 |
tggatgtggctaattatctttacagtatgttgatccttcattaccttcaattgtcatttggtagtactcatggctaactttacaagaagggtcctggctt |
39092048 |
T |
|
| Q |
200 |
ggatcatttgattgtgtctgctagcaagaacattttatagaaatctatattaagtagataaggctcattaaaattttgtag |
280 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092047 |
ggaccatttgattgtgtctgctagcaagaacattttatagaaatctatattaagtagataaggctcattaaaattttgtag |
39091967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University