View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8611_high_1 (Length: 346)
Name: NF8611_high_1
Description: NF8611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8611_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 4 - 339
Target Start/End: Complemental strand, 52199773 - 52199438
Alignment:
| Q |
4 |
gtttggtgttcacaggacagcatcgctgaaatctgaagttgcagtgattggtgggagtggtaagtacgagaatgcaaggggatatgcagctcttgagaca |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52199773 |
gtttggagttcacaggacagcatcgctgaaatctgaagttgcagtgattggtgggagtggtaagtacgagaatgcaaggggatatgcagctcttgagaca |
52199674 |
T |
|
| Q |
104 |
ctgctgaaagaggatcagcacaccacggatggagtcgacaccatcatccatttcaatatctaccttactcactaatatgaatatctactttcattctcat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52199673 |
ctgctgaaagaggatcagcacaccacggatggagtcgacaccatcatccatttcgatatctaccttactcactaatatgaatatctactttcattctcat |
52199574 |
T |
|
| Q |
204 |
tggctttcatgccattttgcatttgatgttttgaattctgcatgcccactggttaagatagataaaaatgagttatatttccacaccctttttcatgcaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52199573 |
tggctttcatgccattttgcatttgatgttttgaattctgcatgcccactggttaagatagataaaaatgagttatatttccacaccctttttcatgcaa |
52199474 |
T |
|
| Q |
304 |
cacgtttttagaattttggttttcttttgatgtcca |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52199473 |
cacgtttttagaattttggttttcttttgatgtcca |
52199438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 44 - 168
Target Start/End: Original strand, 6735309 - 6735433
Alignment:
| Q |
44 |
gcagtgattggtgggagtggtaagtacgagaatgcaaggggatatgcagctcttgagacactgctgaaagaggatcagcacaccacggatggagtcgaca |
143 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||||||| || |||||||| || |||||| || ||||| ||||| || |||||||| ||||| | |||| |
|
|
| T |
6735309 |
gcagtgattggtgggactgggaagtatgagaatgctagaggatatgctgcaattgagaacctactgaaggaggaccaacacaccacagatggggctgaca |
6735408 |
T |
|
| Q |
144 |
ccatcatccatttcaatatctacct |
168 |
Q |
| |
|
||||| | ||||||| ||||||||| |
|
|
| T |
6735409 |
ccatcttgcatttcagtatctacct |
6735433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University