View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8612_high_3 (Length: 256)
Name: NF8612_high_3
Description: NF8612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8612_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 18600024 - 18599778
Alignment:
| Q |
1 |
tgttgcaaaagaaatggtcctcaaggagactattattgattatggcattaggttttggaattggagttgtctattatggtatgccactagggcttggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18600024 |
tgttgcaaaagaaatggtcctcaaggagactattattgattatggcattaggttttggaattggagttgtctattatggtatgccactagggcttggaaa |
18599925 |
T |
|
| Q |
101 |
cttgtcctttaatctttatctaagtgtcacttttaatgccttaagtgagataccatcttcattggtaacatttttcttcatagacaagtttaaaaggaga |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18599924 |
cttgtcctttaatctttacctaagtgtcacttttaatgccttaagtgagataccatcttcattggtcacatttttcttcatagacaagtttaaaaggaga |
18599825 |
T |
|
| Q |
201 |
attgcattgtttgtgttttgtatcataagtggtgttttgagtataat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18599824 |
attgcattgtttgtgttttgtatcataagtggtgttttaagtataat |
18599778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University