View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8612_high_5 (Length: 239)
Name: NF8612_high_5
Description: NF8612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8612_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 46411300 - 46411072
Alignment:
| Q |
1 |
taagtttgacacatgtcttgagattttgagttaagatgtactgtttaannnnnnnnnngt----gtggttgtttattatccaatataaatgatcctcaga |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46411300 |
taagtttgacacatgtcttgagattttgagttaagatgtagtgtttaattttttttttttttttgtggttgtttattatccaatatgaatgatcctcaga |
46411201 |
T |
 |
| Q |
97 |
cttccctcataacccaacaatgtatcagagtttatgactaccaaatagatcgactcattatgtcgaaagtcttcgtgacaatggggtcaaacacgcgttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46411200 |
cttccctcataacccaacaatgtatcagaatttatgactaccaaatagatcgactcattatgtcgaaagtcttcgtgacaatggggtcaaacacacgttc |
46411101 |
T |
 |
| Q |
197 |
tgtctattgcggctaacaaagttgtaagt |
225 |
Q |
| |
|
|| |||||| ||||||||||||||||||| |
|
|
| T |
46411100 |
tgcctattgtggctaacaaagttgtaagt |
46411072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University